{ "conflicts": [], "coverage": { "cells": { "ADD-apo": { "rfam_covariation": 0, "xray": 1 }, "ADD-bound": { "rfam_covariation": 0, "xray": 8 }, "ADD-intermediate": { "rfam_covariation": 0, "xray": 1 } }, "data_levels": { "ADD-apo": { "xray": "processed" }, "ADD-bound": { "xray": "processed" }, "ADD-intermediate": { "xray": "processed" } }, "single_method_states": [ "ADD-apo", "ADD-intermediate", "ADD-bound" ], "states": [ "ADD-apo", "ADD-intermediate", "ADD-bound" ], "techniques": [ "xray", "rfam_covariation" ], "unmapped_evidence": 3 }, "curation": { "as_of": "2026-10-19", "curator": "draft (unreviewed)", "file": "URS000080DF85_672.yaml", "status": "draft" }, "evidence": [ { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus A-riboswitch (chains X); same sequence", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=1Y26", "evidence_id": "EV-NAKB-1Y26-1", "mappings": [ { "confidence": "high", "justification": "Adenine (ADE) bound, this exact sequence; anchor structure.", "rule": "curator_assignment", "state_id": "ADD-bound", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.1 }, "provenance": { "deposit_id": "1Y26", "doi": "10.1016/j.chembiol.2004.11.018", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=1Y26" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "A-riboswitch-adenine complex" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "29G" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Mutated adenine riboswitch aptamer (chains A); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=4LX5", "evidence_id": "EV-NAKB-4LX5-1", "mappings": [ { "confidence": "low", "justification": "Engineered M6'' aptamer bound to a synthetic ligand (PPDA) instead of adenine; bound fold assumed similar.", "rule": "curator_assignment", "state_id": "ADD-bound", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.13 }, "provenance": { "deposit_id": "4LX5", "doi": "10.1021/ja502873j", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=4LX5" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "X-ray crystal structure of the M6\" riboswitch aptamer bound to pyrimido[4,5-d]pyrimidine-2,4-diamine (PPDA)" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "29H" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Mutated adenine riboswitch aptamer (chains A); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=4LX6", "evidence_id": "EV-NAKB-4LX6-1", "mappings": [ { "confidence": "low", "justification": "Engineered M6C'' aptamer bound to a synthetic ligand (PPAO) instead of adenine; bound fold assumed similar.", "rule": "curator_assignment", "state_id": "ADD-bound", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.15 }, "provenance": { "deposit_id": "4LX6", "doi": "10.1021/ja502873j", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=4LX6" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "X-ray crystal structure of the M6C\" riboswitch aptamer bound to 2-aminopyrimido[4,5-d]pyrimidin-4(3H)-one (PPAO)" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus Adenine Riboswitch (chains X); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=4TZX", "evidence_id": "EV-NAKB-4TZX-1", "mappings": [ { "confidence": "medium", "justification": "Structure with adenine modelled and not titled as an intermediate or transitional state; adenine-bound aptamer structures share the bound fold.", "rule": "add-adenine-bound", "state_id": "ADD-bound", "who": "rule:add-adenine-bound" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.01 }, "provenance": { "deposit_id": "4TZX", "doi": "10.1016/j.str.2014.07.011", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=4TZX" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Vibrio Vulnificus Adenine Riboswitch variant, grown in Mg2+" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" }, { "concentration_mM": null, "ion": "Sr2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus Adenine Riboswitch (chains X); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=4TZY", "evidence_id": "EV-NAKB-4TZY-1", "mappings": [ { "confidence": "medium", "justification": "Structure with adenine modelled and not titled as an intermediate or transitional state; adenine-bound aptamer structures share the bound fold.", "rule": "add-adenine-bound", "state_id": "ADD-bound", "who": "rule:add-adenine-bound" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.57 }, "provenance": { "deposit_id": "4TZY", "doi": "10.1016/j.str.2014.07.011", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=4TZY" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Vibrio vulnificus Adenine Riboswitch Variant, grown in both Sr2+ and Mg2+" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio Vulnificus Adenine Riboswitch (chains X); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=4XNR", "evidence_id": "EV-NAKB-4XNR-1", "mappings": [ { "confidence": "high", "justification": "Title: aptamer domain in complex with adenine (PLOR-synthesised).", "rule": "curator_assignment", "state_id": "ADD-bound", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.21 }, "provenance": { "deposit_id": "4XNR", "doi": "10.1038/nature14352", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=4XNR" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Vibrio Vulnificus Adenine Riboswitch Aptamer Domain, Synthesized by Position-selective Labeling of RNA (PLOR), in Complex with Adenine" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus strain 93U204 chromosome II, adenine riboswitch aptamer domain (chains A,B); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=5E54", "evidence_id": "EV-NAKB-5E54-1", "mappings": [ { "confidence": "high", "justification": "Title: two apo structures of the aptamer domain; no adenine modelled.", "rule": "curator_assignment", "state_id": "ADD-apo", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.3 }, "provenance": { "deposit_id": "5E54", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=5E54" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Two apo structures of the adenine riboswitch aptamer domain determined using an X-ray free electron laser" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus strain 93U204 chromosome II, adenine riboswitch aptamer domain (chains A,B); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=5SWD", "evidence_id": "EV-NAKB-5SWD-1", "mappings": [ { "confidence": "high", "justification": "Title: aptamer domain in an intermediate-bound state.", "rule": "curator_assignment", "state_id": "ADD-intermediate", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.5 }, "provenance": { "deposit_id": "5SWD", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=5SWD" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Structure of the adenine riboswitch aptamer domain in an intermediate-bound state" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "Vibrio vulnificus strain 93U204 chromosome II, adenine riboswitch aptamer domain (chains X); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=5SWE", "evidence_id": "EV-NAKB-5SWE-1", "mappings": [ { "confidence": "high", "justification": "Title: ligand-bound structure converted in crystal from the ligand-free state.", "rule": "curator_assignment", "state_id": "ADD-bound", "who": "curator:draft (unreviewed)" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 3.0 }, "provenance": { "deposit_id": "5SWE", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=5SWE" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Ligand-bound structure of adenine riboswitch aptamer domain converted in crystal from its ligand-free state using ligand mixing serial femtosecond crystallography" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "RNA (71-MER) (chains X); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=5UZA", "evidence_id": "EV-NAKB-5UZA-1", "mappings": [ { "confidence": "medium", "justification": "Structure with adenine modelled and not titled as an intermediate or transitional state; adenine-bound aptamer structures share the bound fold.", "rule": "add-adenine-bound", "state_id": "ADD-bound", "who": "rule:add-adenine-bound" } ], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 2.22 }, "provenance": { "deposit_id": "5UZA", "doi": "10.1038/nprot.2018.002", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=5UZA" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Adenine riboswitch aptamer domain labelled with iodo-uridine by position-selective labelling of RNA (PLOR)" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "adenine riboswitch aptamer variant (chains A,B); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=6VWT", "evidence_id": "EV-NAKB-6VWT-1", "mappings": [], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 3.03 }, "provenance": { "deposit_id": "6VWT", "doi": "10.1038/s41467-021-21838-5", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=6VWT" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Transitional unit cell 1 of adenine riboswitch aptamer crystal phase transition upon ligand binding" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_vitro", "ions": [ { "concentration_mM": null, "ion": "K+" }, { "concentration_mM": null, "ion": "Mg2+" } ], "ligands": [ "ADE" ], "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "adenine riboswitch aptamer variant (chains A,B); other construct of the same Rfam family (RF00167) and organism, 71 nt", "labels": [] }, "data_format": "mmCIF + structure factors", "data_level": "processed", "data_link": "https://www.nakb.org/atlas=6VWV", "evidence_id": "EV-NAKB-6VWV-1", "mappings": [], "molecule_id": "URS000080DF85_672", "observable": { "type": "resolution", "uncertainty": null, "unit": "Å", "value": 3.0 }, "provenance": { "deposit_id": "6VWV", "doi": "10.1038/s41467-021-21838-5", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "NAKB", "url": "https://www.nakb.org/atlas=6VWV" }, "reader": null, "source_kind": "deposit", "technique": "xray", "title": "Transitional unit cell 2 of adenine riboswitch aptamer crystal phase transition upon ligand binding" }, { "conditions": { "applied_force_pn": null, "buffer": null, "environment": "in_silico", "ions": [], "ligands": [], "notes": "Rfam release 15.1.", "ph": null, "salt_mM": null, "temperature_c": null }, "construct": { "description": "positions 2-69 of 71 match the family covariance model; type Cis-reg; riboswitch;; consensus structure source: Published; PMID:12787499", "labels": [] }, "data_format": "Stockholm (SS_cons), covariance model", "data_level": "processed", "data_link": "https://rfam.org/family/RF00167", "evidence_id": "EV-RFAM-RF00167-2-69", "mappings": [], "molecule_id": "URS000080DF85_672", "observable": { "type": "family_coverage", "uncertainty": null, "unit": "fraction", "value": 0.944 }, "provenance": { "deposit_id": "RF00167", "doi": null, "licence": "CC0 1.0", "retrieved": "2026-10-19", "source": "Rfam", "url": "https://rfam.org/family/RF00167" }, "reader": null, "source_kind": "computed", "technique": "rfam_covariation", "title": "Rfam RF00167 (Purine): Purine riboswitch aptamer" } ], "models": [ { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-5E54-1" ], "file": "models/URS000080DF85_672/ADD-apo.cif", "format": "mmCIF", "model_id": "ADD-apo-cif", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "5E54", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/5E54.cif" }, "state_id": "ADD-apo" }, { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-5E54-1" ], "file": "models/URS000080DF85_672/ADD-apo.pdb", "format": "PDB", "model_id": "ADD-apo-pdb", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "5E54", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/5E54.pdb" }, "state_id": "ADD-apo" }, { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-5SWD-1" ], "file": "models/URS000080DF85_672/ADD-intermediate.cif", "format": "mmCIF", "model_id": "ADD-intermediate-cif", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "5SWD", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/5SWD.cif" }, "state_id": "ADD-intermediate" }, { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-5SWD-1" ], "file": "models/URS000080DF85_672/ADD-intermediate.pdb", "format": "PDB", "model_id": "ADD-intermediate-pdb", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "5SWD", "doi": "10.1038/nature20599", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/5SWD.pdb" }, "state_id": "ADD-intermediate" }, { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-1Y26-1" ], "file": "models/URS000080DF85_672/ADD-bound.cif", "format": "mmCIF", "model_id": "ADD-bound-cif", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "1Y26", "doi": "10.1016/j.chembiol.2004.11.018", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/1Y26.cif" }, "state_id": "ADD-bound" }, { "assumptions": null, "basis": "observed", "constraints_used": [ "EV-NAKB-1Y26-1" ], "file": "models/URS000080DF85_672/ADD-bound.pdb", "format": "PDB", "model_id": "ADD-bound-pdb", "molecule_id": "URS000080DF85_672", "provenance": { "deposit_id": "1Y26", "doi": "10.1016/j.chembiol.2004.11.018", "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used", "retrieved": "2026-10-19", "source": "RCSB PDB", "url": "https://files.rcsb.org/download/1Y26.pdb" }, "state_id": "ADD-bound" } ], "molecule": { "components": [], "domains": [ { "end": 69, "name": "Purine riboswitch aptamer (Rfam RF00167)", "start": 2 } ], "gene": null, "identifiers": { "genbank": null, "isoform": null, "nakb": null, "pdb": [], "rfam": "RF00167", "rnacentral": "URS000080DF85_672", "uniprot": null }, "ligands": [], "modifications": [], "molecule_id": "URS000080DF85_672", "molecule_type": "rna", "name": "A-riboswitch from Vibrio vulnificus (PDB 1Y26, chain X)", "organism": { "name": "Vibrio vulnificus", "taxon_id": 672 }, "provenance": { "deposit_id": "URS000080DF85_672", "doi": null, "licence": "CC0 1.0 (verify)", "retrieved": "2026-10-19", "source": "RNAcentral", "url": "https://rnacentral.org/rna/URS000080DF85/672" }, "sequence": "CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG", "sequence_length": 71 }, "molecule_id": "URS000080DF85_672", "states": [ { "assumptions": [], "basis": "observed", "description": "Aptamer without adenine, as in 5E54 (room-temperature XFEL structure; two conformers in the asymmetric unit, apo1 and apo2, which differ in the length of P1). The 5E54 construct has a different P1 sequence from this page's sequence, so no pairing is given here.", "family_label": { "terms": { "aptamer": "aptamer_unbound" }, "vocabulary": "riboswitch" }, "molecule_id": "URS000080DF85_672", "name": "ligand-free aptamer", "parent_state": null, "population": null, "provenance": { "deposit_id": null, "doi": null, "licence": "Project licence (pending decision)", "retrieved": "2026-10-19", "source": "Conformome curation (URS000080DF85_672.yaml)", "url": "https://github.com/matth55/conformome/blob/HEAD/curation/URS000080DF85_672.yaml" }, "representative_model": "ADD-apo-cif", "secondary_structure": null, "state_id": "ADD-apo", "status": "draft" }, { "assumptions": [], "basis": "observed", "description": "Adenine bound to an aptamer that has not yet reached the fully bound fold, trapped by mix-and-inject serial crystallography, as in 5SWD. Same construct as 5E54.", "family_label": null, "molecule_id": "URS000080DF85_672", "name": "ligand-bound intermediate", "parent_state": null, "population": null, "provenance": { "deposit_id": null, "doi": null, "licence": "Project licence (pending decision)", "retrieved": "2026-10-19", "source": "Conformome curation (URS000080DF85_672.yaml)", "url": "https://github.com/matth55/conformome/blob/HEAD/curation/URS000080DF85_672.yaml" }, "representative_model": "ADD-intermediate-cif", "secondary_structure": null, "state_id": "ADD-intermediate", "status": "draft" }, { "assumptions": [], "basis": "observed", "description": "Aptamer folded around adenine, as in 1Y26 (2.1 Å, Mg2+): P1, P2 and P3 around a three-way junction, the L2-L3 kissing loop (G37-C61, G38-C60; brackets [ ]), the U22-A52 pair of the binding pocket (brackets { }) and adenine paired with U74.", "family_label": { "terms": { "aptamer": "aptamer_bound" }, "vocabulary": "riboswitch" }, "molecule_id": "URS000080DF85_672", "name": "adenine-bound aptamer", "parent_state": null, "population": null, "provenance": { "deposit_id": null, "doi": null, "licence": "Project licence (pending decision)", "retrieved": "2026-10-19", "source": "Conformome curation (URS000080DF85_672.yaml)", "url": "https://github.com/matth55/conformome/blob/HEAD/curation/URS000080DF85_672.yaml" }, "representative_model": "ADD-bound-cif", "secondary_structure": { "dot_bracket": "((((((((({..((((((......[[.))))))(.....})((((((]].....))))))..)))))))))", "source": "1Y26, canonical cWW pairs from FR3D (BGSU RNA 3D Hub), author numbering 13-83 = positions 1-71" }, "state_id": "ADD-bound", "status": "draft" } ], "transitions": [] }