{
  "conflicts": [],
  "coverage": {
    "cells": {},
    "data_levels": {},
    "single_method_states": [],
    "states": [],
    "techniques": [
      "xray",
      "nmr_structure"
    ],
    "unmapped_evidence": 14
  },
  "curation": {
    "as_of": "",
    "curator": "none",
    "file": "",
    "status": "uncurated"
  },
  "evidence": [
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [],
        "ligands": [],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + NMR restraints",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=143D",
      "evidence_id": "EV-NAKB-143D-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "structure",
        "uncertainty": null,
        "unit": null,
        "value": null
      },
      "provenance": {
        "deposit_id": "143D",
        "doi": "10.1016/0969-2126(93)90015-9",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=143D"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "nmr_structure",
      "title": "SOLUTION STRUCTURE OF THE HUMAN TELOMERIC REPEAT D(AG3[T2AG3]3) OF THE G-QUADRUPLEX"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3 (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=1KF1",
      "evidence_id": "EV-NAKB-1KF1-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.1
      },
      "provenance": {
        "deposit_id": "1KF1",
        "doi": "10.1038/nature755",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=1KF1"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Structure and Packing of Human Telomeric DNA"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [],
        "ligands": [],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*(BGM)P*DGP*DGP*DTP*DTP*DAP*(BGM)P*(BGM)P*DGP*DTP*DTP*DAP*(BGM)P*DGP*DG)-3') (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + NMR restraints",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=2E4I",
      "evidence_id": "EV-NAKB-2E4I-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "structure",
        "uncertainty": null,
        "unit": null,
        "value": null
      },
      "provenance": {
        "deposit_id": "2E4I",
        "doi": "10.1111/j.1742-4658.2007.05881.x",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=2E4I"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "nmr_structure",
      "title": "Human Telomeric DNA mixed-parallel/antiparallel quadruplex under Physiological Ionic Conditions Stabilized by Proper Incorporation of 8-Bromoguanosines"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [],
        "ligands": [
          "RUL"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "human_telomere_quadruplex (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + NMR restraints",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=2MCC",
      "evidence_id": "EV-NAKB-2MCC-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "structure",
        "uncertainty": null,
        "unit": null,
        "value": null
      },
      "provenance": {
        "deposit_id": "2MCC",
        "doi": null,
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=2MCC"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "nmr_structure",
      "title": "Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "Na+"
          }
        ],
        "ligands": [
          "2FJ"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "human telomere quadruplex (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + NMR restraints",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=2MCO",
      "evidence_id": "EV-NAKB-2MCO-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "structure",
        "uncertainty": null,
        "unit": null,
        "value": null
      },
      "provenance": {
        "deposit_id": "2MCO",
        "doi": null,
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=2MCO"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "nmr_structure",
      "title": "Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "BER"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (22-mer) (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=3R6R",
      "evidence_id": "EV-NAKB-3R6R-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.4
      },
      "provenance": {
        "deposit_id": "3R6R",
        "doi": "10.1093/nar/gks1001",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=3R6R"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Structure of the complex of an intramolecular human telomeric DNA with Berberine formed in K+ solution"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "R8G"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "Human telomeric repeat sequence (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=3SC8",
      "evidence_id": "EV-NAKB-3SC8-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.302
      },
      "provenance": {
        "deposit_id": "3SC8",
        "doi": "10.1021/ja2102423",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=3SC8"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide BMSG-SH-3"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "T5E"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "human telomeric DNA sequence (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=3T5E",
      "evidence_id": "EV-NAKB-3T5E-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.1
      },
      "provenance": {
        "deposit_id": "3T5E",
        "doi": "10.1021/ja2102423",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=3T5E"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide BMSG-SH-4"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "0DX"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "human telomeric DNA sequence (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=3UYH",
      "evidence_id": "EV-NAKB-3UYH-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 1.95
      },
      "provenance": {
        "deposit_id": "3UYH",
        "doi": "10.1021/jm301899y",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=3UYH"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of an intramolecular human telomeric DNA G-quadruplex bound by the naphthalene diimide compound, MM41"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "MMP"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=4FXM",
      "evidence_id": "EV-NAKB-4FXM-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 1.651
      },
      "provenance": {
        "deposit_id": "4FXM",
        "doi": "10.1021/ja3088746",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=4FXM"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of the complex of a human telomeric repeat G-quadruplex and N-methyl mesoporphyrin IX (P21212)"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "MMP"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=4G0F",
      "evidence_id": "EV-NAKB-4G0F-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.15
      },
      "provenance": {
        "deposit_id": "4G0F",
        "doi": "10.1021/ja3088746",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=4G0F"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of the complex of a human telomeric repeat G-quadruplex and N-methyl mesoporphyrin IX (P6)"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=6IP3",
      "evidence_id": "EV-NAKB-6IP3-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 1.4
      },
      "provenance": {
        "deposit_id": "6IP3",
        "doi": "10.1093/nar/gkz419",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=6IP3"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Structure of human telomeric DNA at 1.4 Angstroms resolution"
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "EDO",
          "V4A"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "DNA (5'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') (chains A,B); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=6XCL",
      "evidence_id": "EV-NAKB-6XCL-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 2.7
      },
      "provenance": {
        "deposit_id": "6XCL",
        "doi": null,
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=6XCL"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal Structure of human telomeric DNA G-quadruplex in complex with a novel platinum(II) complex."
    },
    {
      "conditions": {
        "applied_force_pn": null,
        "buffer": null,
        "environment": "in_vitro",
        "ions": [
          {
            "concentration_mM": null,
            "ion": "K+"
          }
        ],
        "ligands": [
          "P6G"
        ],
        "notes": "Ligands and ions are those modelled in the entry; concentrations, pH and temperature are not in NAKB's index.",
        "ph": null,
        "salt_mM": null,
        "temperature_c": null
      },
      "construct": {
        "description": "telomeric DNA (chains A); same sequence",
        "labels": []
      },
      "data_format": "mmCIF + structure factors",
      "data_level": "processed",
      "data_link": "https://www.nakb.org/atlas=7KLP",
      "evidence_id": "EV-NAKB-7KLP-1",
      "mappings": [],
      "molecule_id": "DNA-6f16b68e4fba",
      "observable": {
        "type": "resolution",
        "uncertainty": null,
        "unit": "Å",
        "value": 1.35
      },
      "provenance": {
        "deposit_id": "7KLP",
        "doi": "10.1093/nar/gkaa1177",
        "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
        "retrieved": "2026-10-19",
        "source": "NAKB",
        "url": "https://www.nakb.org/atlas=7KLP"
      },
      "reader": null,
      "source_kind": "deposit",
      "technique": "xray",
      "title": "Crystal structure of a three-tetrad, parallel, K+ stabilized human telomeric G-quadruplex"
    }
  ],
  "models": [],
  "molecule": {
    "components": [],
    "domains": [],
    "gene": null,
    "identifiers": {
      "genbank": null,
      "isoform": null,
      "nakb": "143D",
      "pdb": [
        "143D"
      ],
      "rfam": null,
      "rnacentral": null,
      "uniprot": null
    },
    "ligands": [],
    "modifications": [],
    "molecule_id": "DNA-6f16b68e4fba",
    "molecule_type": "dna",
    "name": "Human telomeric G-quadruplex d[AG3(T2AG3)3]",
    "organism": {
      "name": "Homo sapiens",
      "taxon_id": 9606
    },
    "provenance": {
      "deposit_id": "143D",
      "doi": "10.1016/0969-2126(93)90015-9",
      "licence": "PDB-derived fields: CC0 1.0 (wwPDB archive); NAKB annotations not used",
      "retrieved": "2026-10-19",
      "source": "NAKB",
      "url": "https://www.nakb.org/atlas=143D"
    },
    "sequence": "AGGGTTAGGGTTAGGGTTAGGG",
    "sequence_length": 22
  },
  "molecule_id": "DNA-6f16b68e4fba",
  "states": [],
  "transitions": []
}